Detailed information on CNT309611


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30694665Zea maysOryza sativa29.6233.4384.62117forward
CNT30670880Zea maysSetaria viridis15.9529.4410063forward
CNT30552718Zea maysOryza glaberrima41.7718.591.52165forward
CNT30139418Zea maysLolium perenne42.7815.1289.35169forward
CNT30343341Zea maysEragrostis tef2015.0896.279forward
CNT30364817Zea maysSorghum bicolor41.7722.0390.91165forward
CNT30595697Zea maysOryza meridionalis22.5318.8693.2689forward
CNT30575127Zea maysOryza barthii41.7713.2191.52165forward
CNT30583774Zea maysEchinochloa crusgalli41.779.6792.12165forward

Expression of CNT309611

Sequence

>CNT309611
CGGAAAGCCTACAGCAGCGGACGACTAAGAAAAACAACATGGGACACACTAAGTTGACGAATTTGCCTACTTGTACTTGATGGCAGCTCTAGCGATGGCA
CTGCAGTAAGCCTTCGTCTCTGTGCCCAAATGATCTCTCTTCCCGTCTAAAAGACTGACGACTAACGATTAGATAGCGTCCTCTCAGCTCTGCGAGCGGC
GGCGGCTAGAACTTCTTGTTGTACCAGAAGACGCCCTTGCGGTCCTCGGGCTCGACGTAGATGCACTCCCTGGCCTCGCGCCAGGTCGCCTTGGCAACAG
GGGTCGGGTCGAAGTGGTAGTAGTCCCCGAGGATGGGCCTGATCGCCTTGGTGGCCTCCATGGCGTGGTAGAGCGCCGCGGCGATCACCAGGTCG