Detailed information on CNT30725748


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONTAET000445, E-value = 9e-105

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30725748

Sequence

>CNT30725748
AGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGG
AACAAAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAAGCGTGGCCTATCGATCCTTTAGTCCTTCGGAATTTGAAGCTA
GAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCG