Detailed information on CNT30724469


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30547369Lupinus angustifoliusIpomoea triloba20.988.6187.564forward
CNT30379183Lupinus angustifoliusManihot esculenta20.6622.1892.0663reverse complement
CNT30591720Lupinus angustifoliusMusa acuminata24.2623.287.8474forward
CNT3084328Lupinus angustifoliusVigna radiata51.1551.3285.26156forward
CNT30214836Lupinus angustifoliusHelianthus annuus48.5247.7482.43148forward
CNT30619930Lupinus angustifoliusCajanus cajan49.1824.9688.67150forward
CNT30354850Lupinus angustifoliusLactuca sativa207.6688.5261forward

Expression of CNT30724469

Sequence

>CNT30724469
GCCGAGTTGATTAACACCAGCTTGTAACCCAAGTGGGGGCATCAAGGTGATGGAACAGTTCCATGGCTTGTCTGGTTGGACTGTTGAGTGCATTATGATT
GGCTTGCCCACTCCAAGTTGAGAGTTGATTCATGTGACCTGAGCTAAGGCACAGGTCTCATGGGTCCTAGACTAGAGGACACAGCGTGAGGCTGGCTTCA
CAGAGCAGCGATAACCTCTGGCTCTCAACAGTGGAGGGATAACAGGCTGCAGCACTACCAGTCCATTATGACCTGGTGAGCCTGGCTGCTTGAACCATCA
CCTTT