Detailed information on CNT30723252


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30144582Lupinus angustifoliusMedicago truncatula10.6721.7487.6965forward

Expression of CNT30723252

Sequence

>CNT30723252
TCCTATATCAATCATAAAAATTAAACCCATTACATATAATGGCAATTAAGAATACAGAATAATGTATATTCTTGTATTCTTATATTACGAGATAAGTTAT
CTACCCGGTTCATAAAAAATGTGACATCTATTATACCATTGTGTCAACCTATTATGGTTGTACAAAACCTAACTTCATCCTATTAAAATTATCAACCCAA
AAAAAGGGTAACTAAACCATGACTATATAGCAAAGGCAAGAGATAGAATAGACCTTGTTGGCCTTGCTCTTTTCAAGGGCACCTCTTCTTCCTTCACTTG
CTTGTGATTCTTTGGCTTGTGGAATTCTGGCTTGCTGAGCCTTGATCACATGCAACTTCTGACCAGAGACTGGTGGTGATGCAACTGAAGGCATGGAAGT
GAGCTTAGCATTGAGTTCTGAGCAACCAGAACCAGATATGGTGTAGGTACAAGCCAAGACACTAGAATTCATGGCAGCCATGGATGAAGATTTTTGTAAT
CTTGATCAGAGTTGTATGGAAAATTAACTTGATTTGCAAATGGGGTGCTTAGTCTTAGAGGGTATTTTATTTTTTGTTTGTTTGAGGCTAAGGATGTGTG
ACAAGGAGT