Detailed information on CNT30709723


BLAST search results

BLAST vs Swiss-Prot:
sp|Q9S728|PDF1_ARATH, E-value = 6e-33

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30727751Glycine maxCorchorus capsularis54.710.9785.16128forward
CNT30378906Glycine maxManihot esculenta41.4530.7983.5197forward
CNT30195446Glycine maxPisum sativum60.6823.8790.85142forward
CNT30492653Glycine maxOlea europaea24.366.487.7257forward
CNT30145046Glycine maxMedicago truncatula67.9560.6988.68159forward
CNT30610290Glycine maxGossypium raimondii54.715.6981.25128forward
CNT30648894Glycine maxRosa chinensis34.1919.7587.580forward

Expression of CNT30709723

Sequence

>CNT30709723
GTTGGAGTTGAGTGAGGCCACAAACCTGTCCCTGACTTGGTTGGTTGTGTAAGGGAACTTGTTGTTCACCATGGAGTTGAGGAAGGAAGCTGTGCCTTCT
CTGTAGAGTGCTCCTAGCCCATCAGTTCTTGTGTTGGAAAGTGCTTGTGGCAAGCTAAGGCCAGGACTGAACCCTGGAACAGTAGTACCTGTCACACCAA
ATGCACTTCCTAGGGTTCCCCACCAGCCAAGGAT