Detailed information on CNT30708121


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONGMAT000067, E-value = 0.0

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30523536Glycine maxSetaria italica44.1351.8682.25293forward
CNT30508904Glycine maxSolanum lycopersicum65.8170.7180.09437forward
CNT30606053Glycine maxGossypium raimondii32.3835.684.65215forward
CNT30625810Glycine maxDaucus carota61.7560.4780.98410forward
CNT30620207Glycine maxCajanus cajan28.018.6694.09186forward
CNT30354733Glycine maxLactuca sativa72.895578.72484forward
CNT30573855Glycine maxVitis vinifera54.5260.1383.43362forward
CNT3051605Glycine maxAmborella trichopoda40.6640.7282.59270forward
CNT30330867Glycine maxDioscorea rotundata65.9660.5878.77438forward

Expression of CNT30708121

Peptides detected in this lncRNA

>peptide 1 (29 aa)
DYMDLMETISDCLENMLTKDYTLLTADCN*

>peptide 2 (29 aa)
MWDCSWVMWGCSSVMWESRMDWWANKLDL*

Sequence

>CNT30708121
GGGACTATATGGACTTGATGGAGACAATCTCGGACTGCTTGGAGAATATGCTAACGAAGGACTATACTTTGCTGACTGCGGATTGTAACTAGGGGACGTA
GGGCTATATGATGGTGAGGTAGGGCTATACGATGGCGAGGTTGGGCTGTATCCAGGTGATGTGGGGCTGTAAGCAGGTGATGTAGGACTATATGATGGAG
ACGTCGGACTGTAAGAGGGTGATGTAGGGCTGTAGGAAGGTGAAGTGGGGCTGTAAGCTGGTGAAGTTGGGCTATAGCTGGGAGAGGTAGGGCTGTAGCT
GGGTGATGTGGGACTGTAGCTGGGTGATGTGGGGCTGTAGCTCGGTGATGTGGGAGAGTAGGATGGACTGGTGGGCGAATAAGCTGGACTTGTAGGACTA
TATCCCGGAGAGCTAGGACTATAAGTCGGAGAGGTGGGGCTGTACCCGGGTGAAGTGGGGCTGTACCCAGGTGAAGTGGGGCTGTACCCGGGTGATGAGG
GACTATAGCCTGGGGATGATGGGCTGTAACCAGGAGATGAAGTAGGAGAAAATGCCATCCCACCAACATAAGGTGAAAACTGTGCATCAGTAGTTGGAGA
CAGCCGTAAATTGGGGCTCAACAAATAACTGGGAGACATCAGGCCTTCATGATATGGAGTTCCA