Detailed information on CNT30697529


BLAST search results

BLAST vs Swiss-Prot:
sp|P31093|PSAN_HORVU, E-value = 9e-23

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30676742Oryza sativaSetaria viridis26.2114.9693.52108forward
CNT30523702Oryza sativaSetaria italica28.8823.893.28119forward
CNT30436158Oryza sativaAegilops tauschii14.5620.1393.3360forward
CNT30658022Oryza sativaTriticum dicoccoides14.5622.2293.3360forward
CNT30137831Oryza sativaLolium perenne21.620.6587.6489forward
CNT305897Oryza sativaZea mays26.2123.2389.81108forward
CNT30680368Oryza sativaTriticum urartu14.5622.8193.3360forward
CNT30349480Oryza sativaEragrostis tef16.2627.3591.0467forward
CNT30597167Oryza sativaOryza meridionalis30.8320.55100127forward
CNT30371436Oryza sativaOryza glumipatula62.8635.3387.64259forward
CNT30104555Oryza sativaOryza rufipogon63.3535.8100261forward
CNT30582696Oryza sativaEchinochloa crusgalli25.7320.3194.34106forward
CNT30551854Oryza sativaOryza brachyantha23.0613.4897.8995forward

Expression of CNT30697529

Sequence

>CNT30697529
AATTTGTGAAAGTAATGAAGTGATGAGACCTTCTGCTTGGCGAGGTCCTGGCAGCCGGTGAAGTTGTAGGGGAACTGGCAGCTGCCGAACTCGACGGTGT
ACGCCCTCGCGAAGTTGGCGCCGCTCGTCGCCAGCCTCTTCTTGTCGTACTCGTCGAACACGCCGGCCTTGGCCTGCCCGGCGGCGGTGGCGGCGAACAC
GGCGGCGAGACCCAGCAGCGCGGCGCGCCTGCCACCGCCCTGCTCCTCCTTGGGCGGCACAGCGACGTGCACGCGCTTCGGCACCGGCGAGGCGGCCGAC
TGCGGCACCGCCGCGGCGGGCTTGAGGCCGACGACGCTGGTGCTCACTCCGGCCATGGCTCGAGCTGCGCGTGTGCAAGAATTTGGTTGGTTGGAGACGA
CGACCAGGACGG