Detailed information on CNT30695846


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30554851Oryza sativaOryza glaberrima84.7640.42100445forward
CNT30596860Oryza sativaOryza meridionalis84.7650.5799.33445forward
CNT30371021Oryza sativaOryza glumipatula93.1481.599.8489forward
CNT30103490Oryza sativaOryza rufipogon84.7652.29100445forward
CNT30117503Oryza sativaOryza nivara75.8182.7499.5398forward

Expression of CNT30695846

Sequence

>CNT30695846
ACACCATACAGCAAACATAGTATAAACATTGTCATAGAGAGTACAGCTGATAGCAGCTTGTAATATTCTAGCATTACTTTGGTAGCATCCCTCTACAAAA
CATAGCAGACATCACCAGCTCTTCATCTTGGCCATACACATTCAACCTGACAAGAAAACCATATCCCATTTTACAACATATGTAATCTGTACATGAAAAT
GTATCTACAAGAAATCAAAATAGTAGGTAGTGTGGAGTGCCTTACATGGTTTGCTAGTGACAGACCACACTGACCAGAACATTTCGTCTCCTCAGTAGCA
TCATTTTGCAGAAGGTTGTCCATTGATTCATCTGAGCTGCTCTCAACATAAGGTAATGGCAAATACTTCATCTCGGGATCGAAGGTGGGCATGTTTTGTG
CGAGATTAGGCATGCCATTTCCCTGGGGCACGGCGATACCATAGTGGAGCTAGTTTCTCTTGCTTGGCAGCGTTTTGCTTCAGGGAGAGCTTCTGAGCAA
CAGCTGGTTCATCAGGAAAGTTGAC