Detailed information on CNT30695540


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30102816Oryza sativaOryza rufipogon96.6572.38100519forward
CNT30577318Oryza sativaOryza barthii46.7438.6799.6251forward
CNT30117418Oryza sativaOryza nivara96.6574.3699.81519forward

Expression of CNT30695540

Peptides detected in this lncRNA

>peptide 1 (29 aa)
MKSSSGVVGNPHTHLSRRRRRRASGLMGG*

Sequence

>CNT30695540
ATTGTATGAAAAAAAAAAGCCCAAGCCTTGATAGGAGTTATACACATGAAAAACAACCCAAACTTGGTTGAGTTAGCCCCTCTCGAGAGTAAAACACGGC
CACTAATCTCAAAAAGCTAAGATTAACGTCATCATTTTCACCATATACCCCACGCGCAATTTACTAATTAATCGGAAACTGATGAAATCATCATCGGGTG
TAGTTGGAAACCCCCACACCCACCTGAGCCGCCGCCGCCGCCGCCGGGCGAGTGGGCTCATGGGAGGTTGAGGAACACGGCGGTCGGGTCCGGGTCGGCC
AGACTCTTGGTGATGGACGGGTAGTCGGAGAAGTCGAGGCCGAGGGTGACGGCGGCGGAGTCCGGCTGCAGGAGGTCCGTGAACGAGTCCTCCTCCACGG
CCGGGACGACGAGCTCCGTGGTGATCTCGCTCGTGGTGTCAGGCGCCGGCGGTGTCGTCGTCGTTGTGGAAGTCGTCGTCTTCTTCTCCGACGTAGCTTC
GGTCGTCGTCTTGGCGGCGGAGTCAGCGGCGGCTTCG