Detailed information on CNT30695493


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30675793Oryza sativaSetaria viridis18.2736.8287.8474forward
CNT30117445Oryza sativaOryza nivara10092.0599.51405forward

Expression of CNT30695493

Sequence

>CNT30695493
GGAACACATTGCATATCAAAATATGAAACAGCAAAGACAAAATAAACGAAGATATCTCGACAAGTAGACCACAGAATAAAAGAGCTAGATATAAGAATGT
AGAACGGTTTCATTCTAATAGGACCATCCAAGGAGGTTTGAGGTTCTCATCCCACAGACACAGATTCTCGATAACACCATATCAAAACTCAAAACTTGAG
AGTACTTTAAGTGAACCTAAAAGACACAACATAAGATAGTCTTGCAAAGCATAGGCGGACTGGCTAACATCTGTGGACTGCTTAGTCGAACAAGCTGAAA
CCCATGTCATCGACGCTGCGGTGCTCGAGGAGCTTGGCGAAGAGACCGGGCCAGTAGGCCTCGACCTTGATGTTGGCCGCCTTCACCAGGGTGGCGATCT
TCTCA