Detailed information on CNT30695394


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT004671, E-value = 3e-95

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30695394

Sequence

>CNT30695394
AAATAAATTATTACAGAGGTGGATAGTTCCTCTCAAAGAATAACTTTCTACGCAGCGGAAAAAAAATAAAACTATAACAAACTACGGAACAGCTATGGCG
ACTCCACTCCACAGGCATCTTAACCAGAACAAGCTCAATCCTTCAGATCATCACCTTCGCTGAAATACTCCTCTTCTGATGATTGAATATTGCAAGAATG
AGC