Detailed information on CNT30694985


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30244606Oryza sativaAvena sativa14.8422.5991.861forward
CNT30668750Oryza sativaTriticum dicoccoides10.7121.8993.1844forward
CNT30445180Oryza sativaSaccharum spontaneum15.5728.8395.3164reverse complement
CNT30102558Oryza sativaOryza rufipogon91.97103.8589.15378forward
CNT30604390Oryza sativaOryza punctata59.6199.5991.43245forward

Expression of CNT30694985

Sequence

>CNT30694985
CAGGAATTCGTTTACGTGGGTCGCTCTAGGATTGCAAACTCGGGTAAGATAACGAAAAACAGACACTGAGGACTTAGGGAGATAAAACTGCCATAAGACA
AAAGTCACAATTGCAGTGCCATCTAAAGACATGCATCACATTGGATTCGACGAGCATTAAGCAAGAAAACTTGATTCAGCAGAAAGCCAATCCTTGCTAG
AGTAAATGTCAGACGATGATACTTGAATACATGATATGGTCTGCTTAAATTAAGTTCCTAATAACATTGAAGTATGAAGCACAATAGACCCACAACTTCA
GTATCCAGTAGGTAGTTTAGAAAAGAGACGTTCCCTTGCCCTTCTTGTCTCCACCAATTTTAAAATGCTTGCACCTCTGCACAGAATAATTATGTAAGTG
AGCATCCAACA