Detailed information on CNT30694344


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT005424, E-value = 5e-91

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30102187Oryza sativaOryza rufipogon91.4768.21100236forward

Expression of CNT30694344

Peptides detected in this lncRNA

>peptide 1 (50 aa)
HLGQVDAELCRHARRDPPPPCARGVVVGRSAAAATPQATPTPPCLRMAAD*

>peptide 2 (60 aa)
PPWSGRRRALPPRTPRSAAAVCKRCSCREIRRRRHAPGHADPSLPPHGGGLKLLPPSSRN*

Sequence

>CNT30694344
CCACCTTGGTCAGGTCGACGCCGAGCTCTGCCGCCACGCACGCCGAGATCCGCCGCCGCCGTGTGCAAGAGGTGTAGTTGTCGGGAGATCCGCCGCCGCC
GCCACGCCCCAGGCCACGCCGACCCCTCCCTGCCTCCGCATGGCGGCGGACTGAAGCTGCTGCCGCCCTCGAGCAGAAACTGAACCCCACCGGCGGAGTG
CTTCTCGGCGAGCTCGCGACCGGGATGAGGAGAACGGGAGCAATGTGGAGAGTTCGAG