Detailed information on CNT30694147


BLAST search results

BLAST vs Swiss-Prot:
sp|Q2R8L1|RGA5S_ORYSJ, E-value = 5e-06

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30694147

Peptides detected in this lncRNA

>peptide 1 (29 aa)
MERLEGRELLNGCIKYLTFFLCRPVCCHT*

>peptide 2 (29 aa)
LLPKVSFPIKIKDHEVGQCPKYQHGFTFL*

Sequence

>CNT30694147
CTTCTCCCCAAGGTAAGCTTTCCGATAAAGATCAAGGACCATGAGGTTGGGCAATGCCCCAAGTATCAGCATGGTTTTACCTTCCTTTAGTTTGCTCCTC
AATAAGTAGATCTTCTTCAGGTGAGTGAGCTGCTCAATCCAGTTAGGCATCTCTTCAAGACTTCCATTCAACCTGAGTGTCCTTAGTAGGGGAGGAGGAG
ATGAAATAGAATCTAGGCACTCAAGTGTTCCAATAATACCTGAGAATAACACAGCATCCACATGGAGAGATTGGAGGGAAGAGAGCTTCTCAATGGCTGC
ATAAAGTATCTTACATTTTTCCTTTGTCGACCCGTTTGTTGTCACACCTAATTTCCTCAGCTTGCTTAACTGCCCCAGCTCTTTGATTGCTCTACTACTG
GTCCGCCTGATATCTACATACTCTAGAACCTGTAAGTCTCGCAAC