Detailed information on CNT30692141


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30317088Oryza sativaCorylus avellana27.2725.0382.51183forward
CNT30616476Oryza sativaSesamum indicum28.1738.185.19189forward
CNT30589607Oryza sativaMusa acuminata47.5481.3886.83319forward
CNT30553135Oryza sativaOryza glaberrima6259.0999.76416forward
CNT30132965Oryza sativaLolium perenne36.9654.0394.76248forward
CNT301476Oryza sativaZea mays14.1628.9697.8995forward
CNT30231426Oryza sativaAnanas comosus36.6631.3489.02246forward
CNT30345256Oryza sativaEragrostis tef39.3451.3692.05264forward
CNT30361694Oryza sativaSorghum bicolor11.9236.298.7580forward
CNT30596031Oryza sativaOryza meridionalis54.199.1898.07363forward
CNT30573153Oryza sativaVitis vinifera24.5926.1581.21165forward
CNT30148558Oryza sativaBrachypodium distachyon8.7924.2898.3159forward
CNT30101081Oryza sativaOryza rufipogon10055.0999.85671forward
CNT30116289Oryza sativaOryza nivara10085.8199.85671forward
CNT30113588Oryza sativaFicus carica30.2532.1784.73203forward

Expression of CNT30692141

Sequence

>CNT30692141
ATATATTTGAGCACTAGTACAAAAACAAACAAACAAATAGCATGAGCTCTCCGTAGTGGCGGTCGTTGTAGTTGCGGATCACAATCATATCATTTCGATA
TTCCAATCCACCTACTACCAAGAAGCCTCTTCTTGTTCGGATCAGTTCATCGGCTCATCGCAGGGAGGAAACAAATATCTTGTCCTCGATTCCTCTTCCT
TATCAGTGATACGATACACACCGCACATGCCGCAATTAACACTAAACTAATCAGGCAGCTCGATCTGCATCTCCATCAATTATTGGCAGAGTAGTAACAG
TAGCAATTGGAACTTGGAAGTGATGTACAGCGCGGGTTGAGCTAGTTGGTGAAGTTGTTGAGGCAGGCGTGGGGCTCGGTGGCCTTGGCGGCTGGCGTTG
GCTCGACGGTCGGGGATGCCCTTGAGGTAGAAGGTGTAGAAGATCTTGAAGGGGAAGACGATCTGGTTGAGCTTGACCTGGCCGTAGGCGCCTTCGAAGA
CGCCGGAGCCGCCGGTGACGGCGAGGTAGGACTCCTCGTAGGTCAGGTACGGGCCCTGCACGGAGATGTGGCCGTAGTCGCCGAAGTAGAAGCTGTAGAT
GGCCTCGTAGCGGTCGCCGTTGCGCTCCGGCACGTGCTGGATCAGGATGCAGATCCCCGCCGAGATCCCCA