Detailed information on CNT30692067


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30369951Oryza sativaOryza glumipatula7469.0198.48461forward
CNT30105375Oryza sativaOryza longistaminata97.7591.0395.24609forward
CNT30100935Oryza sativaOryza rufipogon74.1680.3598.27462forward
CNT30575676Oryza sativaOryza barthii99.3656.5398.87619forward

Expression of CNT30692067

Sequence

>CNT30692067
CTTGCTCCCTCCTCGCTCCCTCTCACACGACATGAGCAGCCCTAGATCGTCCGGGGTTGGAGCAACTGTTGTGTGAGGAGATCAAATCTTGATGGTCATT
ATTAGCTGAAAAGGATTGGATTTTTACCGCAGAGACAGTATCTGAGCTGTGTTTCTCAGTGCCTCCCATGTTCTTGCACCAACCAAGCTAGAACTTGGAA
AGGAACACCACCATCACCAATTTGCAAGAGAAGGTTCTCTCCCTTGTATTATAACCACAACTATATTGATTCGAGATTAAAGAGAAGGGCACAGTGAGGA
TACTGGCATTTGGAGGCTTGTTGAATCCAGGTGCGTGTGCCACCTCTCCCGAAAGGCCAAAAAAAACCACTGCTGCGAGTGCGAGTGTGCAACTTTCCTG
CAAGAAACAGTGAGCCGAACACACCGGCTCTGTTCTTGGCTAATTAAACCCCAATTGCGGCGCTGTTTGGATTCAGTTCTTCGCAATTCTTGGATTCCCC
AGCAGCAACTGTTCTTCCCCAACCGAGAGCCCAAATCTTTGATCCAAAACTTTGAACCAGATAGAAGCCATGGTTTCTCGGTCCTACTCCAACCTGCTGG
ACCTGGCCACCGGCGCGGCGGAC