Detailed information on CNT30691920


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30552958Oryza sativaOryza glaberrima10091.0399.79467forward
CNT30369966Oryza sativaOryza glumipatula10063.899.79467forward
CNT30101080Oryza sativaOryza rufipogon92.72105.3594.69433forward
CNT30575941Oryza sativaOryza barthii10065.9699.14467forward
CNT30116402Oryza sativaOryza nivara79.44100.2799.46371forward

Expression of CNT30691920

Sequence

>CNT30691920
CTGGAGGAAACTTTTATTTGACAGTACGCATTAAAATAACAAGATACATATATTAGATGATCGATCTGATCATCAATAATCACACTGATAGATCGAGATA
AGTATATATGTATGACACAACTGCAACACACAGACTAAGCCATGCAAAGCTTAAGCCTTAATTAGGTAGCTAGGGTTGTGGTGGTAATGAAGATTAAGAA
TCAGATGAGTGGGCAGGAGAAGTCGGAAGGGCAGGTCTTGTGGCAGTAGTTGAGGAGGAGGACGAGGTCGACGAGCCCCCCCAGCAGCGGGCAGCACTCC
TCGCTCGCCGGCACCCCCACCTTGAGCTTGAGCAGGTTGAGCACGTTGGCGCACACGCTCAGCTTCAGCGCGTCGATCGGGCACTTATTCCCTCCACCCG
ACGGCGGCGACGGAGGCGGCGTCACCGGCGGCGTCGGTGTGGGGCAGTAGGGCTCGCATGCCTGCAC