Detailed information on CNT30690898


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30230656Oryza sativaAnanas comosus12.5323.1194.2352forward

Expression of CNT30690898

Sequence

>CNT30690898
GCCTTAAACTAATGAGTAAGGAAAACAAAGCGTTGCGGTGAGAGCCGCTCGCGGTGCGGGACTCAAACCCTGCACGGCAATTTTTGCGAGGGGAAGAGGC
TCGCGCGGGTATTGACACTGCTTACTTTTGCAGGACTTGCCTGTGTGGGCCTCCCTACCCACAAAATACCAAATCTAAATTTAGCTATAGTTAATTAAAT
AGAACTCTTTTTAAAAAAATTCAAATTTGATTTGTAATAAATTATAGTAATATTTATAATAAAAACAAATATTGTATTAAAATATGTTTAATATAAAATA
AAATTAAATTGTAGTACTTCGATTTAATGTGAGTTATTTTAGCATTTTTTATATTCGTATTACATTTGTATTGATGTTAATGAATTTAAAGAGTATTGAT
GTTAATGAATTTAAA