Detailed information on CNT30690289


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30555829Oryza sativaOryza glaberrima10017.7295.87218forward
CNT30370925Oryza sativaOryza glumipatula10021.6594.5218forward
CNT30106405Oryza sativaOryza longistaminata54.135.4198.31118forward
CNT30103060Oryza sativaOryza rufipogon54.5915.2289.08119forward
CNT30577365Oryza sativaOryza barthii54.5912.9586.55119forward
CNT30117295Oryza sativaOryza nivara10019.6895.41218forward

Expression of CNT30690289

Sequence

>CNT30690289
CATCGCCGGCCGTCTCCCTCCTGTTGCCACTCTAGCTGGCACTCTTCCATCTACAAGGGTGTTTTAGACATTAGAAACCACACATAACATGAAAATGAAG
GAAAACTAACAGAAGGGGCATGGAAGGGATCAAAGCAAAATTTTAGGGGTACAGAGGGGATCGTGTAAAATTGGAGGGTATAGAAGAGATTAGGTGAGTT
TTCATGTGTACAGAAGGG