Detailed information on CNT30690180


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30575051Oryza sativaOryza barthii91.1820.6799.71341forward

Expression of CNT30690180

Peptides detected in this lncRNA

>peptide 1 (34 aa)
MDRSWSMRRMRRREEIGWLIDPRRSWRRSRLRPS*

Sequence

>CNT30690180
AAAGCATTGGCGTGTCTTAGAACCAAAAGCAGGGGATAGAATTGCTGCTTTTTAGCCTCCAATTTCCAATCTACCAAGAAAGAAACTAGTAGTAGTTGAG
AATCGCAATTATTAGTAGAAAGAATCTAGGGCTAGTGGTCTTTTAATCGGTTGTATATACACTTAAAATTTCCACCGCACACGGCACGCTCGGATGGATG
GATGGATAGGAGTTGGTCAATGAGGAGGATGAGGAGAAGGGAAGAAATTGGGTGGTTGATTGATCCTAGGCGATCTTGGCGAAGGAGCCGCCTCCGGCCA
TCATGACCTTGAATTCCTCGAAGGAGATGAGGCCGTCGCCGACGCGGGCGAGCTCGGCGGCGGAGATGGTGCCG