Detailed information on CNT30689956


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT006137, E-value = 7e-78

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30689956

Sequence

>CNT30689956
ATGGAGTTTAGTAGAGTAAAAGCCGTTTCTTTTCCGTTGGTCGTGTAGACGCTGCAGCTTCGGAAGATCCGCTCTTCGTGGAAGTTGAAGCCGACGTTTG
GGAAAGCGAGCAAGTAAGAGAAGCTTTGGAGAAGAAGTCTTAGGTGGAGTCTTGGCTTATACCCCAGTTGAGCGCCTGTGAAGATGGAGCCGTAGGCCCG
CTAGTCCGCTGCTGTTTATTTTTGATTGTCAGGCCTTAAGTGCCTTTGTAATAATGTAAATATTATC