CANTATAdb - search

Detailed information on CNT30618210

BLAST search results

BLAST vs Swiss-Prot:
sp|Q06GM9|PETD_PIPCE, E-value = 1e-20

BLAST vs NONCODE:
NONORUT002109, E-value = 5e-29

Results of reciprocal BLAST search (potential orthologs)

Target	Query species	Target species	Query coverage (%)	Target coverage (%)	Identity	Alignment length (nt)	Orientation
CNT30632357	Sesamum indicum	Vigna unguiculata	50.72	17.92	93.33	105	reverse complement
CNT30201894	Sesamum indicum	Pisum sativum	49.28	5.73	92.16	102	reverse complement
CNT30504292	Sesamum indicum	Nicotiana attenuata	50.72	5.89	97.14	105	reverse complement
CNT30708642	Sesamum indicum	Glycine max	50.72	22.01	93.33	105	reverse complement
CNT3090412	Sesamum indicum	Solanum tuberosum	50.72	4.76	93.33	105	reverse complement
CNT30193370	Sesamum indicum	Secale cereale	50.72	6.5	93.33	105	reverse complement
CNT30286546	Sesamum indicum	Triticum aestivum	50.72	7.08	93.33	105	reverse complement
CNT30395700	Sesamum indicum	Triticum turgidum	42.51	18.97	92.05	88	reverse complement
CNT30556068	Sesamum indicum	Oryza glaberrima	50.72	14.31	91.43	105	reverse complement
CNT30145111	Sesamum indicum	Medicago truncatula	50.72	23.49	91.43	105	reverse complement
CNT30435040	Sesamum indicum	Aegilops tauschii	50.72	11.68	93.33	105	reverse complement
CNT30668000	Sesamum indicum	Triticum dicoccoides	50.72	34.65	93.33	105	reverse complement
CNT30309624	Sesamum indicum	Camelina sativa	49.28	24.17	91.18	102	reverse complement
CNT30230699	Sesamum indicum	Ananas comosus	50.72	17.98	92.38	105	reverse complement
CNT30655374	Sesamum indicum	Rosa chinensis	50.72	18.01	93.33	105	reverse complement
CNT30215737	Sesamum indicum	Helianthus annuus	50.72	34.43	94.29	105	reverse complement
CNT30679835	Sesamum indicum	Triticum urartu	42.03	6.78	88.51	87	reverse complement
CNT30622073	Sesamum indicum	Cajanus cajan	50.72	26.18	95.24	105	reverse complement
CNT30357898	Sesamum indicum	Lactuca sativa	37.68	3.91	94.87	78	reverse complement
CNT30421666	Sesamum indicum	Papaver somniferum	50.72	19.77	91.43	105	reverse complement
CNT3025179	Sesamum indicum	Populus trichocarpa	50.72	13.12	96.19	105	reverse complement
CNT30104480	Sesamum indicum	Oryza rufipogon	50.72	20.71	90.48	105	reverse complement

Expression of CNT30618210

Peptides detected in this lncRNA

>peptide 1 (29 aa)
FSREWWVVAQCHKPRQKKKDIKTCSCIKS*

Sequence

>CNT30618210
CTTTTTCAAGGGAGTGGTGGGTAGTAGCACAGTGTCATAAACCCAGACAAAAGAAAAAAGACATCAAAACATGTTCCTGTATTAAGAGCTAAATCGGCTA
AAGGTATGGGTCATAATTATTACGGAGATCCCGCATGGCCCAATGATCTTTTATATATTTTTCCAGTAGTAATTCTAGGAACATATTAAAGATGTTAAAG
AATGAGA