Detailed information on CNT30604326


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONOSAT000909, E-value = 1e-34

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30694351Oryza punctataOryza sativa55.4138.2684.96246forward

Expression of CNT30604326

Peptides detected in this lncRNA

>peptide 1 (96 aa)
GWLPNALSSVKLNLLNKSPPAIASMSAYARAEARTRLVRRKDQLAASCRATPQAPSALPFPFSPVVEERCLVDSERPKHAFGFKGVPVDLILQSTR*

Sequence

>CNT30604326
GGTTGGCTACCTAACGCTTTGTCTTCGGTCAAACTGAACCTCCTCAATAAGAGCCCCCCTGCAATTGCCTCAATGAGCGCGTACGCGCGAGCTGAGGCTC
GTACGCGGCTGGTGAGACGAAAGGATCAGCTAGCTGCTAGCTGCCGCGCAACTCCGCAAGCTCCAAGCGCTCTCCCGTTCCCTTTCTCTCCTGTGGTGGA
GGAGAGATGCCTAGTGGACTCTGAACGTCCAAAACATGCTTTCGGGTTCAAGGGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGATGAAACATGCAA
GTTCTATTAGTAAATGATAATCGATCGGCTAGAGAGCCGATGTCATATCGTGATGTAACCTAGCTGATGCATTGTAAGACGAATCGGCTGTAAGGCATAT
TCAATAACAGATCAACCCTAAATATGATCCATCGGCTATAAATA