Detailed information on CNT30603883


BLAST search results

BLAST vs Swiss-Prot:
sp|Q32SG5|RIK_MAIZE, E-value = 1e-08

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30692367Oryza punctataOryza sativa41.9318.8194.59148forward
CNT30369844Oryza punctataOryza glumipatula41.9322.9594.59148forward
CNT30105946Oryza punctataOryza longistaminata41.937.7194.59148forward
CNT30100816Oryza punctataOryza rufipogon41.9313.0394.59148forward
CNT30575866Oryza punctataOryza barthii41.937.8194.59148forward

Expression of CNT30603883

Peptides detected in this lncRNA

>peptide 1 (92 aa)
ASLVFNTLGSFVGNCAEHKFGGETEFRSKDLGGAIGLFKSERLSSFLDISFEGNLGGGGGMLLGGGGGMFLGGGGGGMFLDGNVCEGICCRS*

Sequence

>CNT30603883
GCCTCGCTAGTTTTTAACACTCTGGGCTCCTTTGTAGGTAATTGTGCTGAACATAAATTTGGTGGTGAGACTGAATTCAGGTCCAAGGATCTCGGGGGTG
CCATTGGCTTGTTTAAATCTGAACGCCTATCCTCATTTCTTGACATCTCATTTGAAGGGAACTTAGGTGGTGGCGGAGGCATGCTCTTGGGAGGTGGTGG
TGGCATGTTCCTGGGTGGTGGTGGCGGTGGCATGTTCTTGGATGGAAATGTATGTGAAGGAATATGCTGCCGATCTTGAAGAAGCATCCCATTTGATCCA
GGCTGAACTTTAATTGGAGGTTCAATCGATGAATTGGACATGTTACCTAAATC