Detailed information on CNT30603482


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30552139Oryza punctataOryza glaberrima45.4830.6893.59312forward
CNT30108880Oryza punctataOryza longistaminata46.3623.6192.45318forward
CNT30574993Oryza punctataOryza barthii40.5271.194.24278forward

Expression of CNT30603482

Peptides detected in this lncRNA

>peptide 1 (34 aa)
RGGSSIRRNATPLRRAAAGSKMRGWKNPIANLPS*

>peptide 2 (28 aa)
MAESGLTETIYVQLLLSGAEYVELALLVL

>peptide 3 (29 aa)
REEEAAFGGMPHLFGERPRDLKCEAGRTP*

Sequence

>CNT30603482
AGAGAGGAGGAAGCAGCATTCGGCGGAATGCCACACCTCTTCGGCGAGCGGCCGCGGGATCTAAAATGCGAGGCTGGAAGAACCCCATAGCGAACTTGCC
GTCCTGAGAGATCAACTTCTGGTCACCAGAGAGAGGCTGGTTTGCAGTGAGCATATCATCGGCATGCAAGGGATTCTCATGGATTGAAAGAATCAATACG
ATCATGGACAGCATGCACGAAGAAAACCGGCAAGTCGCCATTTCATGCACACAATCTGGCAATGCAAAAAACTGAGACTCCCTGGGCCTATATATTCGAC
TATCTGCATTCAAAGCTAATGGCATGAGTAACTGGCTTGGCTAAGAACAACGAGTGTCAACCCCTGTACTCCGAAACTCGACTCAAACTAAGAAAGGTGA
CCGAATTGAGCTGACTTTCTGGCTGTTTGAAGACGAAGTACGTTGATTAAGGAAGTTAATTGGCCTGACCTGACATTTGAGGTTTCATTTCGTTGACATT
CGTTGCCAGATGCCGGCTTTGCACTCCTTTTTTTATTGTGGTTAGATAGCTAGCAGCCCACGATACAGGAATGCTTGTGTCTACACTCTATGGTTGTACA
TGGCTGAATCTGGACTGACGGAAACTATATACGTGCAGCTTCTGCTATCTGGGGCAGAATATGTAGAATTAGCCCTACTCGTCCTT