Detailed information on CNT30603472


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30690094Oryza punctataOryza sativa45.572891.43175forward
CNT30552014Oryza punctataOryza glaberrima57.2954.4690.45220forward
CNT30595443Oryza punctataOryza meridionalis42.9741.8892.73165forward
CNT30369383Oryza punctataOryza glumipatula58.3354.588.84224forward
CNT30575057Oryza punctataOryza barthii57.2955.2890.45220forward
CNT30115761Oryza punctataOryza nivara57.2954.7390220forward

Expression of CNT30603472

Peptides detected in this lncRNA

>peptide 1 (38 aa)
RQTTRIHDSLISRRINSTGTSHHTNHTLIHAESPKRPA*

Sequence

>CNT30603472
AGGCAAACCACACGAATACACGATTCATTAATTTCACGGCGAATAAATAGCACGGGTACATCACATCACACAAATCATACGTTGATACACGCAGAGTCGC
CGAAACGACCAGCTTAATTAACTAATCGATACTACACGGGTTTAATTCAGCAATAATCAGCGCACACACAAACCACGCATATGGTGATTTTTATTGTGGA
CTAATTAAGGTAGGTGGTTGACACGGCCGGCGGCGAGGGCGCAGCTGTTGCCGCACTTGTCCGACATGGTCGAAGATTTAGCCAATCGAGTGATGAATTA
ATTCCTTGTGTTGCTTATGAGCTTCTTGTGCTTATTAGCTAGCTCTGGTGGTGAGGAGCAATGGCTGCCTCAGCTGGTGGTATA