Detailed information on CNT30597242


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30695966Oryza meridionalisOryza sativa100.254.5293.87489forward
CNT30109911Oryza meridionalisOryza longistaminata48.9838.7494.56239forward
CNT30102949Oryza meridionalisOryza rufipogon63.5231.0393.87310forward
CNT30575755Oryza meridionalisOryza barthii45.987.590.62224forward
CNT30117497Oryza meridionalisOryza nivara101.4347.9293.13495forward

Expression of CNT30597242

Peptides detected in this lncRNA

>peptide 1 (47 aa)
EPLRPSFINLCRSRIPKEPTRGGPRREILFFFPNSGRRRHSFLSPSL*

>peptide 2 (59 aa)
LSHFARASSTSVDQESRRNRREVDHGGRSSSSSPTPAADAIPFFLLLCRSPGVHRRRRP*

Sequence

>CNT30597242
CTGAGCCACTTCGCCCGAGCTTCATCAACCTCTGTAGATCAAGAATCCCGAAGGAACCGACGCGAGGTGGACCACGGAGGGAGATCCTCTTCTTCTTCCC
CAACTCCGGCCGCCGACGCCATTCCTTTCTTTCTCCTTCTCTGTAGAAGCCCGGGGGTACACCGTCGACGACGACCGTAGCAGCCGCGCCGTCGCCGAAC
CAGTACACCGTCGCCAAGACTTCATCGAGCCGCGTTTGCTGCTTGACGATTCGCAGCCGAGTCACGAGGAAACCTACCTTTTAGCTGAGCAAGGAGTGGA
AGAGCAAGGCAAGCCACCTCCCCTCTTTGATCACACTGAACCTATGATTTGGAGGTTTTTGAAAAGATTGCAAAATATGCATGTCTATTGTACACTAATC
TATTAAAATCTTGTAAAATTTGTTAGATCAACTCCTTAACTTGCATTATCACCTAAACTCCACAAAAGACCTTAACCATTATTCCAAA