Detailed information on CNT30597095


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT003882, E-value = 3e-144

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30690379Oryza meridionalisOryza sativa69.873491.54473forward
CNT30103007Oryza meridionalisOryza rufipogon56.8723.3292.99385forward
CNT30116168Oryza meridionalisOryza nivara62.7831.591.06425reverse complement
CNT30550983Oryza meridionalisOryza brachyantha12.726.3894.1986forward

Expression of CNT30597095

Peptides detected in this lncRNA

>peptide 1 (29 aa)
LAWWRCSAGVKRFKASMGIATHLCRVYEL*

Sequence

>CNT30597095
CTGGCGTGGTGGCGGTGTAGCGCGGGCGTTAAAAGGTTTAAGGCGTCTATGGGTATAGCGACACACCTCTGCAGAGTGTATGAATTGTGATATGTCACTC
CCTGTTTCGGATAGAAACTGCGAACACTGCGAACACGGCAGGAAAGGAACCTATCGGAGGTTCTAATACTTGTGGTGCCTTATATGCAATAGATTTTATA
ATTACTTAATACGAGTTTTTACAACAATGTTTTATGAACATGCATAAAATTCCTTGTTGGATTATGGGATTTGGACATATATGTATTGTGTAGGTGGATT
TATGGGCATATATTTGTTGGATTGCTATAGTTGGACTTGTTGAGTATCATTCGTACTCATCCCCTATATATATTATTCCTTGTAGTGTTGAGCTAACAAT
TAGGTGAAGAGAAGATTCTACAAAATTGATCAAGTGTTGCATATCTCTACATCATCTTAATGTTGAAGGTGATGAAGATCTAGAAGAGCAAGGGTTTGTA
ATCACATCGAAGGACTTTACCCATAGCGGAGCTTTTGGGACACTCCTAGTGTTCAACAATGAGAAAGGATTTACTCAAGAGAATGTCGAATCTGTATGTA
AGTTTGGGAATAATCTCAAAGAAGTAATAGCTATTTTGGGGAGAAAGGTGCATCATATGATTATCAGATTAACTCGT