Detailed information on CNT30596698


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30695918Oryza meridionalisOryza sativa27.4221.8189.0282forward
CNT30554895Oryza meridionalisOryza glaberrima40.4754.585.95121forward
CNT30104680Oryza meridionalisOryza rufipogon84.6252.0691.7253forward
CNT30577934Oryza meridionalisOryza barthii29.775.0988.7689forward

Expression of CNT30596698

Sequence

>CNT30596698
GTTTTCCCTCCTTCTCCAATCCTCCTCTTCCTCAAAGCAAATGAGCACAGAAGCCTGAATCACTTCTGGTTTCCTCTGTAGACCTGTAAGTGCTAAACTC
GTTCTATTCCAAAAATTTCTCCATCCACAGCCAAGGCCGGCCGTGCAACCAATCCGCCGTCGTAGACCTTCTACCGCCGCACCACAGCACCCAGCAAGAC
CACCTCTCGTCGATCGCGTTGAAGATCCCACCGGACTCACAGGAATTGAAGTGGAACCAGAAGGCTACATTGAAGCTTCCGAAGGCCACGTTCTACAAG