Detailed information on CNT30596546


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30222413Oryza meridionalisHordeum vulgare35.6953.8893.69111reverse complement
CNT30554486Oryza meridionalisOryza glaberrima40.8419.27100127forward
CNT30253226Oryza meridionalisAvena sativa34.0824.3183.02106reverse complement
CNT30362203Oryza meridionalisSorghum bicolor47.5929.3789.86148forward
CNT30117098Oryza meridionalisOryza nivara38.5927.71100120forward

Expression of CNT30596546

Peptides detected in this lncRNA

>peptide 1 (42 aa)
RKRMRAQARDPPGLRPRPQQKHLLASMTTACAAARRRSAPTP*

>peptide 2 (88 aa)
EEEDEGAGAGSAGLEAAAAAEALAGEHDDGLRGGEEEERADAVAGGDVGAEGDDVEEEDGGEHDDGRHCCRCCCVRWCVVFAAAPRGE*

Sequence

>CNT30596546
GAGGAAGAGGATGAGGGCGCAGGCGCGGGATCCGCCGGGCTTGAGGCCGCGGCCGCAGCAGAAGCACTTGCTGGCGAGCATGACGACGGCCTGCGCGGCG
GCGAGGAGGAGGAGCGCGCCGACGCCGTAGCCGGTGGCGATGTCGGAGCCGAAGGCGATGACGTCGAGGAGGAGGACGGAGGCGAGCACGATGATGGACG
CCATTGCTGCCGCTGCTGCTGCGTGAGGTGGTGTGTGGTGTTCGCGGCTGCTCCTCGTGGGGAGTAGTAGTTAAAAGGAGAGGAGAGAGAGAGAGGGGCG
CGGCGCTGCGG