Detailed information on CNT30596440


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30554142Oryza meridionalisOryza glaberrima46.2115.84100122forward
CNT30370463Oryza meridionalisOryza glumipatula54.1723.64100143forward
CNT30102027Oryza meridionalisOryza rufipogon54.1719.43100143forward
CNT30117021Oryza meridionalisOryza nivara63.2629.35100167forward

Expression of CNT30596440

Peptides detected in this lncRNA

>peptide 1 (87 aa)
VGAVGLLGAADADAEAAGEVELYGGAGAGAVGDDAVGVGEAGELDVEVRVEVGEEVERAVLLPLLVVVVLGRGLLHHRLGLGPGGGDA

Sequence

>CNT30596440
GTAGGAGCTGTAGGACTGCTTGGCGCCGCCGACGCCGACGCCGAGGCCGCAGGTGAAGTCGAGCTCTATGGCGGCGCCGGCGCCGGCGCCGTTGGGGACG
ACGCTGTCGGCGTGGGGGAAGCGGGCGAACTCGACGTTGAGGTAAGGGTCGAGGTCGGAGAAGAGGTTGAGCGCGCCGTGCTGCTGCCGCTGCTGGTGGT
GGTGGTGCTCGGCCGCGGCCTTCTCCACCACCGCCTCGGCCTCGGCCCCGGCGGCGGCGACGCC