Detailed information on CNT30595828


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30691322Oryza meridionalisOryza sativa86.6774.490.69247forward
CNT30369655Oryza meridionalisOryza glumipatula87.7272.8990250forward

Expression of CNT30595828

Peptides detected in this lncRNA

>peptide 1 (50 aa)
MACLRPSGTRLRRRGDRWVGGGGGWGGWGWCEWGGGEEERMTIGRGGWLGW

>peptide 2 (93 aa)
EEVELLATGGATGGGGGGEARVGRRRRGGGRVHGEAVVRVVERHGLPPPLRYATPATRRPVGRRRRRLGGLGLVRVGRRGRRADDDRKRRLAWV

>peptide 3 (40 aa)
MKRSSSSPPEGPPAAAAAEKLGLGDDAAAEDGSMARPWSG*

Sequence

>CNT30595828
ATGAAGAGGTCGAGCTCCTCGCCACCGGAGGGGCCACCGGCGGCGGCGGCGGCGGAGAAGCTAGGGTTGGGCGACGACGCCGCGGCGGAGGACGGGTCCA
TGGCGAGGCCGTGGTCCGGGTAGTGGAACGCCATGGCTTGCCTCCGCCCCTCCGGTACGCGACTCCGGCGACGCGGCGACCGGTGGGTCGGCGGCGGCGG
CGGTTGGGGGGGTTGGGGTTGGTGCGAGTGGGGAGGAGGGGAAGAAGAGCGGATGACGATAGGAAGAGGAGGTTGGCTTGGGTGG