Detailed information on CNT30578363


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30342324Oryza barthiiEragrostis tef31.718.4887.18117forward
CNT30118017Oryza barthiiOryza nivara25.221.3896.7793forward

Expression of CNT30578363

Nothing found.

Sequence

>CNT30578363
AGACTGCCGATCGTAACATATGCACTTCATGTCAGGCTTTGGAAGCACTGATAAGCTAGTTCTTCTTGAGCTGTCTTGATGCATCAAGCAGCACATGGAG
GTCGCTAATTAATTGGTCTGTTGGGCTGCAGCTGATACTTGAGCCGTCTCAGCTGCTTCCTGCACATCTCCACTGGCGTCACTGGGCACATCCACGACCA
TCTTGGAGACACGGAACATGGCCAGGTGGATACTGCCGGGGTCGATGGGAGTGGGGAAGCCCGGGGTGAGGCGCCTCTCGTTGATGTAGGTGCCATTCGT
GCTGTCCAGGTCAGTTACCAACAAGCTCCCCTCTTTCTTCTCCAGCCGTGCGTGCGTCCCAGAAACTGC