Detailed information on CNT30576789


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30368308Oryza barthiiSorghum bicolor18.2842.2488.7898forward
CNT30370404Oryza barthiiOryza glumipatula77.6173.1199.04416forward

Expression of CNT30576789

Sequence

>CNT30576789
GATTTAACCACTGCAGTAATCAACTTGATTAGTATTTCGCACAAACCTCTCTGTTTACCGACAATCAATACATAGTGGTCGGAATATATAGTAGTACCAC
TTGTGATTTCTGAACATTATGAGGAGTGCATGCACTCTGCAGTAGTGTTACATGCAGTGAGCCCCAGTGCAAGATAGCAGTACATGTATTTAATTAGGTG
GCTAATGGCAGATACGACAGAGATGAGTACTAACACCACTGCTCTACAGAAGCAGCTCTAAATGGTTCTGCAGGGGCGTACATCGATTATTATATGACAC
AGGGATCGATCGAGAGCTAGATACTGTGATCAAGTTTCAGATTCATGCATGCATATGCTGTTCTAATTGTTCAGGGCCTGAAGAAGGCAGGGTGAGGGCG
GCCGGTGCCCTGGAAGGAGGTGTTCTTGAGGTGCTCCGGTGCGTTCTCGAAGGAGTGCCTCCTCGCCAGCGAGAGGATCTTCTTGTCGGCGGCCACGAAG
TATGCCATCCCGGCCGCCGTGCAGATGATCAGCGCC