Detailed information on CNT30576442


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30697874Oryza barthiiOryza sativa17.2843.691.85184reverse complement
CNT30604169Oryza barthiiOryza punctata88.5437.0886943forward

Expression of CNT30576442

Sequence

>CNT30576442
ATTGCTGGAGAAAAAATGAAAATCCACATAAGCATCGCTGAGAAGATGCTAAACCGGATGGTAAGTACTAAAATAATGAGTGGGTGAATTTGGCTTAATG
ATCTTTTTCCAGTTATATGATAGTTGCTCCAGTCCACCGTAATATCAAAAGATCCATCCTCTACTCTTGGATTTAATCTCCCGATAGCCACCCTTCTGCA
TCATCTAAAACGAGGACAAACACACAAACCACAAAAAAAAAACTAACTCAGGTCTCAAGTCTAGAATCCACTAAAATTGAGATACTGCAACTGATGGCTG
GCCATCAGGGAAGACCCCACACAGAAACGCCAAGCCAAACAATTCATATGCTGAAATAATCCAGGTAACAATAATCTGCGAAATCAATCAGACCTTGTGT
GCATTCAGAGCTCCAACCCCCAGACCAACCCAGAGACTATCGGATAAACATAGGTAACAATTGAAGGTGATAAAACACAAACCGAACAAGCCAACAGCCT
CCAATCAATAACCTTGTCAACTTGGGAGAAAATTAAGGAATCTGCGATCAACAAAGAAAGACAAAGGCACACCAAAATCTAAGCTACATGTATGAAGCAA
TTCTGATGACCGAAATAGAAACTAAACAGGAAGTTAAGTATTAGGCAAACTAGGAAAAGTATGTTTTGGTTGTAGGATTCTCCAGTAGTCACATCTATCT
TGAAGCTCCAAAATTCCTACGCAATTCCATTTCTGCAGATAAATCCAAGCACTTAAATTCTACCCTTGGTGAGTACTTCTAATGATGAATTGAATAAGGG
GATTTAAAGATTTCACTCAGTGAAGGTTGGCCTTGCAAAATTCTGAGATAGGCCTGCAGTAAGCAAGAGAACATTTATTTGGGAAGAAATTCAACTTTGT
AAATTTTTAACTTCTAATGATGAATTGAAGAGAAAAAGGGTAGTGAGCTTCACTGAGACGAGCCATAACAATTACTCCTATTTAGAGACCTACAGTGAGC
AAGAGTATTATTTTGGAGGAAAGCAGCTTAAGCATAGAAAACATGCACTAAAGACTGAGTGGCAT