Detailed information on CNT30576296


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30522505Oryza barthiiSetaria italica47.3557.9294.62223forward
CNT30640997Oryza barthiiNymphaea colorata28.2434.9186.47133forward
CNT30307403Oryza barthiiTriticum aestivum12.9521.6388.5261reverse complement
CNT30223464Oryza barthiiHordeum vulgare14.0132.6790.9166forward
CNT30391302Oryza barthiiTriticum turgidum26.5425.294.4125forward
CNT30562761Oryza barthiiActinidia chinensis46.9219.9689.14221forward
CNT30135707Oryza barthiiLolium perenne81.5342.0191.93384forward
CNT30202534Oryza barthiiHelianthus annuus56.6955.8678.65267forward
CNT30362074Oryza barthiiSorghum bicolor56.2647.0792.45265forward
CNT30101892Oryza barthiiOryza rufipogon92.7871.4198.86437forward

Expression of CNT30576296

Sequence

>CNT30576296
CTGGTAGCAGGTGATGGTCTGGAAGCAGCGGAGCTCCTGTGAGAAGTCCGGGAGGCCGATGGTGTGGTGCAGGATGCGGTTGGTGCCGTAGTCGTTGGAG
TTGGGCCCGCCGACGATGCAGATCACGGGGAGGTTCTCGCTGTAGGCGCCGGCGATGGCGTTGAGCACGCTGAGGCCACCGACGGTGAACGTGACGGCGC
ACGCGCCGACGCCGCGGGCGCGGGCGTAGCCGTCGGCCGCGTACCCGGCGTTGAGCTCGTTGCAGCAGCCGATGAGCTTGAGCCCGGGCTCGGCGATGAG
GTAGTCGAGCAGGGTGAGGTTGAAGTCCCCGGGGACGGCGAACACGTCGGTGGCGCCGATCTGCACGAGGCGCCTCGCGAGGTGCCTGCCGAGCGTGGCG
CCCGCCGCGCTGGTCACCGGCGGGTGGATGACGGCGTTGGAGCTGACGACGGGCAGCGAGCCGACGGAGTT