Detailed information on CNT30576128


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT004636, E-value = 3e-180

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30693281Oryza barthiiOryza sativa10069.699.34458forward
CNT30101200Oryza barthiiOryza rufipogon10073.8799.13458forward
CNT30117048Oryza barthiiOryza nivara10072.5898.03458forward

Expression of CNT30576128

Peptides detected in this lncRNA

>peptide 1 (65 aa)
ASICSSTSDPARSAGASATATASSSSSRAGAVAAELRLAETVVEVLVLRLVCSHAAAAAAHQSVS*

>peptide 2 (41 aa)
PLSALAPLIPPAPQVPVPLPLLPPPLPVPVPSLLNSGLQKL*

Sequence

>CNT30576128
CGCCTCTATCTGCTCTAGCACCTCTGATCCCGCCCGCTCCGCAGGTGCCAGTGCCACTGCCACTGCTTCCTCCTCCTCTTCCCGTGCCGGTGCCGTCGCT
GCTGAACTCCGGCTTGCAGAAACTGTAGTCGAGGTTCTTGTGCTGCGGTTGGTTTGTTCTCATGCTGCTGCTGCTGCTGCCCACCAAAGCGTGAGCTAGG
ATACCTCTTCTGTAGCAGCGGTTGCAGCCTTGCAGGACTGAAGAAGGTGACGGGGCTGAGGAATCAGTCATATATCCGCTGCTGATCGATGCATTGACGC
TGTCGCACCTGCAGGCTATACTCTGTTGCGGATATATGATTTCTGTGTTTCTAAACCGTTAAGTCGTTAACTGTGTGCACTGTGGTGCTCCTTATAATTC
TGTTCGTTTGAGTACCTGTGAATTGTGATGCATATCTGTGAATAAAAGGAGACGTGCT