Detailed information on CNT30574780


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE:
NONORUT002480, E-value = 2e-153

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30690640Oryza barthiiOryza sativa42.453.9392.27194forward
CNT30101073Oryza barthiiOryza rufipogon22.327.1990.2102forward

Expression of CNT30574780

Peptides detected in this lncRNA

>peptide 1 (42 aa)
SIYLSIYYIIKTALKGVTTFAVGARNSHINRRKRKKIKGEFK*

Sequence

>CNT30574780
ATCTATCTATCTATCTATCTATTATATTATTAAAACAGCTTTGAAAGGAGTCACCACGTTCGCTGTGGGGGCTAGAAATTCCCACATTAATCGGAGAAAA
AGAAAAAAAATAAAAGGAGAGTTCAAGTAGAAATACAATCTAAAAATAACTGAAATTTGGAATTAAAAATAAGCAATATTGAAAGAAGTTTCCATATAAG
AACCAATACGAGATTAATCAAATTTCGAAATAAAAATAAAATAAAATCCAAAATTAGAAAAAAAGTCCAAGTAGAAATACAATTTAAAAAAAAGCTGAAA
TTCGGAATTAAAAATAAGCAATATTGAAAGAAATTTCCATATAAGAACCCAATACGAGATTAATCAAAATTAAAAACAAAAATAAAATAAAATCCAAAAT
TAGAAAAGAAAAGGATAGTCCAAAGCATAATACAATTTAAAAATAGCTGAAATTCGG