Detailed information on CNT30570854


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30675347Vitis viniferaSetaria viridis74.1351.9289.93149forward
CNT30522155Vitis viniferaSetaria italica74.6317.0686.67150forward
CNT30641074Vitis viniferaNymphaea colorata74.6340.8786.67150forward
CNT30534291Vitis viniferaEucalyptus grandis37.3111.779275forward
CNT30377201Vitis viniferaArabidopsis thaliana74.6326.2286150forward
CNT30617295Vitis viniferaSesamum indicum36.8218.0591.8974forward
CNT30728062Vitis viniferaCorchorus capsularis76.6217.6889.61154forward
CNT30381383Vitis viniferaManihot esculenta35.824.193.0672forward
CNT30402401Vitis viniferaBeta vulgaris42.797.2486.0586forward
CNT30196370Vitis viniferaPisum sativum75.6215.9588.82152forward
CNT30486254Vitis viniferaOlea europaea68.6636.0385.51138forward
CNT30708222Vitis viniferaGlycine max68.163489.78137forward
CNT3092760Vitis viniferaSolanum tuberosum68.1619.886.86137forward
CNT30291318Vitis viniferaTriticum aestivum74.6345.0585.33150forward
CNT30223001Vitis viniferaHordeum vulgare71.1451.4485.31143forward
CNT30390564Vitis viniferaTriticum turgidum46.7730.9285.1194forward
CNT30562825Vitis viniferaActinidia chinensis94.5334.4287.89190forward
CNT30542792Vitis viniferaBrassica napus46.2721.4383.8793forward
CNT30511260Vitis viniferaSolanum lycopersicum65.1732.5186.26131forward
CNT30442409Vitis viniferaAegilops tauschii75.1222.5484.77151forward
CNT30253208Vitis viniferaAvena sativa72.6412.1586.3146forward
CNT30261872Vitis viniferaBrassica rapa76.1217.2985.62153forward
CNT30614070Vitis viniferaArabis alpina63.189.1986.61127forward
CNT305432Vitis viniferaZea mays66.1736.2487.97133forward
CNT30608822Vitis viniferaGossypium raimondii69.6520.987.86140forward
CNT30209019Vitis viniferaHelianthus annuus75.6218.286.84152forward
CNT30681848Vitis viniferaTriticum urartu74.6316.9584.67150forward
CNT30722533Vitis viniferaTriticum spelta72.6425.6184.93146forward
CNT30341625Vitis viniferaEragrostis tef71.1414.6785.31143forward
CNT30364844Vitis viniferaSorghum bicolor72.6433.4986.99146forward
CNT30595966Vitis viniferaOryza meridionalis71.1423.3386.01143forward
CNT30369350Vitis viniferaOryza glumipatula74.6321.5888150forward
CNT30433292Vitis viniferaPapaver somniferum72.6413.9384.93146forward
CNT30706519Vitis viniferaPrunus avium74.1317.9791.28149forward
CNT3033661Vitis viniferaTheobroma cacao76.6274.0491.56154forward
CNT3054138Vitis viniferaAmborella trichopoda63.6825.2587.5128forward
CNT3024644Vitis viniferaPopulus trichocarpa72.647.1492.47146forward
CNT30330123Vitis viniferaDioscorea rotundata75.6214.9390.13152forward
CNT3099978Vitis viniferaOryza rufipogon74.6318.5288150forward
CNT30575061Vitis viniferaOryza barthii74.6316.588150forward
CNT30117026Vitis viniferaOryza nivara22.396.795.5645forward
CNT30333708Vitis viniferaCynara cardunculus70.6517.5383.8142forward

Expression of CNT30570854

Sequence

>CNT30570854
CTCGCTCACCCGCCTGAACATCTCTTGAATTGAGGTAGAGTTACCAATGAAGAGTTCTTGTTCTGGACATTGATCATTTGTTCATCCACTTCTTTGGTGC
TCATCTTGCCCCTGAACATAGCTGAGGCAGTGAGGTAGCGGCCATGACGTGGGTCTGCAGCACACATCATGTTCTTGGCATCCCACATCTGCTGGGTGAG
C