Detailed information on CNT30562271


BLAST search results

BLAST vs Swiss-Prot:
sp|P08222|CB22_CUCSA, E-value = 4e-27

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30562271

Sequence

>CNT30562271
CTAGATCAAAATGAATACTATTCAAGCAGTTAAAACGGAAAATTGACATTTTTTGCATTACTACAATCCAATTTACATCACACACTTTCCAAATTCAAAA
CCCTCCTTTTAATTTCCCCTCACTTTCCGGGGACAAAGTTGGTGGCATAAGCCCAGGCATTGTTGTTAACTGGGTCAGCAAGGTGGTCTGCCAAGTTCTC
TAATGGTCCCTTTCCGGTCACTATGGCTTGAACAAAGAACCCAAACATTGAGAACAT