Detailed information on CNT30533752


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30338967Eucalyptus grandisEragrostis tef208.8193.0243forward

Expression of CNT30533752

Sequence

>CNT30533752
ATAATTAGCTATTTAACATCGCATTCTACTTAACAGGGTAAAGGGTGATGAAACTCATTTTCTTTTTACAGGGTTAAAGACCATAGCATTAAACATTTCA
TCTTCAAATCGCTGACAGATTCTGGACAAGTTGAAGCTCGGACTCTAGGAGGTGAAGGTGTCGATGATGGTCGTGCCGAGCGGGTCGAAGAACTTGCCTC
CCGGATAGAGCCGCT