Detailed information on CNT30521744


BLAST search results

BLAST vs Swiss-Prot:
sp|P46690|GASA4_ARATH, E-value = 2e-23

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30521744

Peptides detected in this lncRNA

>peptide 1 (35 aa)
MMQHPDLLDSIPDSANVASLTTTGGETDHEQCTDQ*

Sequence

>CNT30521744
CGAATCTTTTGAGCCTAATTAGTCAATGTTTGGAGAATAATTCACCAATATAAACAAAACGCTACAGTAATTTTGGAACTCCAAAATTAGGCAAATGGCC
TACAACTGGCAGTCTACGACTGCAAATAGCAAGGACATCAGTTCTGACTGGCCCCACTAATGGTCTGGGATTTCCATCATTAGGCAACTAGGCCCGGAGG
ATAATTTTAATTAAGTCCTAGTAATAGAGTAGGACCACTGCTTAAGGAGGGGGATGCACATCAGCACATGGTAGACCCTACCTAGGAATCCTCACTCTTT
TTTTTTTTGAAACTTAGGAATCCTCACTCTCCCCGACTTGTTCTTTCTTAATGCCTCACAAATTAACAGTAGCACTAGCGCATGATGCAGCATCCAGATC
TGCTTGATAGCATCCCAGATTCAGCAAATGTTGCATCACTAACAACTACTGGGGGAGAAACAGATCACGAACAATGCACGGATCAGTAAGCCGGCCAGCT
GCGGGTAGCAATGCCGGCGGGGATCTGAATGATCTCATCCTGATCTAGGGGCACTTGGGCCCTCCTTCCTTGGTCTTCCAGTTGTTGTAGCAGGGGCAGG
CGCCCTTGTTGCCGTAGAACCCGGGGGGCACGCAGAGGCAGGCCTTGTGGTACTGCGTCTGGGAGCACCGCGACGCGCACTTGGACGAGCACTCCCACGG
CTTCAGGTTGCCCCTGCCGTAGCCGTTCCCGTTGCCGCTGCCACCGCCGTTGCCGTTGCCGTTGCCTCTGCCATTGCCGCCGGCCTCCACCTCCT