Detailed information on CNT30521323


BLAST search results

BLAST vs Swiss-Prot:
sp|P05348|RBS_MAIZE, E-value = 7e-71

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30521323

Sequence

>CNT30521323
TCGCCCAATAGTTACAGAAGCGTTCAGATGGGGAAAAATGGAGATAATCAAGCGGTGTTGAACTGAGACGGACAGGTATTTAAGCTTTTTATTTGGCGCC
GCCGGTCTACTCGCTGCCCGGGGGCTTGTAGGCGATGAACATGACGCACTGCACCTGCTTGATGTTGTCGAAGCCGATGATACGGATGTAACAGTCGGGG
TAGGCCTTCTTGCACTCCTCGAACTCAGCGTACACCTGGGTGGCCTCGGTGCAGCCGAACATGGGCAGCTTCCACATGGTCCAGTAGCGCCCGTCGTAGT
AACAGGGAGACGTGCTGTTCTCACGATAGACGAACCCGATCTTGCTGAACTCGAGGCAGGGGATCCAGTTCTTCCGGATCAGGTAGTCGATCTGCTTCAG
GACCTCGTCCGTGGAGAGAGGTGGCAGGTAGGAGAGGGTCTCGAACTTCTTGAGCTGGTCGGTTGAGAGAGGTGGCCGAGGAGGCCATCACGGTCGGCGC
CATGGCTTCCTAGCTAGTGCTAGTATACGCTTACTAGTACTGTATTTACGAAGGAGAAGAAGAGGCGGT