Detailed information on CNT30520888


BLAST search results

BLAST vs Swiss-Prot:
sp|P05348|RBS_MAIZE, E-value = 8e-35

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30520888

Peptides detected in this lncRNA

>peptide 1 (46 aa)
SSSSGSGSRSASGDRRRTWAASTWSSSARRSNRETCCSHDRRTRSC*

>peptide 2 (63 aa)
PVLPDQVVDLLQEIVAEHGQLPHGPVAPVVVTGRRAVLTIDEPDLAELEAGDPVLPDQVVDLL*

Sequence

>CNT30520888
TCCAGTTCTTCCGGATCAGGTAGTCGATCTGCTTCAGGAGATCGTCGCCGAACATGGGCAGCTTCCACATGGTCCAGTAGCGCCCGTCGTAGTAACAGGG
AGACGTGCTGTTCTCACGATAGACGAACCCGATCTTGCTGAACTCGAGGCAGGGGATCCAGTTCTTCCGGATCAGGTAGTCGATCTGCTTTAGGACCTCG
TCCGTGGAGAGAGGTGGCGGCGGCCATCGCGGTGGGGGCCATGGCTTACTAGAGACCAAGCTAGCGAATAAAACTGAAG