Detailed information on CNT30511681


BLAST search results

BLAST vs Swiss-Prot:
sp|P30264|CATA1_SOLLC, E-value = 3e-59

BLAST vs NONCODE:
NONCQUT006985, E-value = 8e-32

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30674192Solanum lycopersicumSetaria viridis17.7726.1189.8359forward
CNT30317874Solanum lycopersicumCorylus avellana63.2586.0779.52210forward
CNT30373064Solanum lycopersicumArabidopsis thaliana33.4319.4484.68111forward
CNT30405515Solanum lycopersicumBeta vulgaris27.116.6388.8990forward
CNT30708847Solanum lycopersicumGlycine max47.5916.4481.65158forward
CNT30398713Solanum lycopersicumTriticum turgidum63.5577.5781.99211forward
CNT30567579Solanum lycopersicumActinidia chinensis25.925.0783.7286forward
CNT30668910Solanum lycopersicumTriticum dicoccoides64.4676.1682.24214forward
CNT30611006Solanum lycopersicumArabis alpina33.4336.5184.68111forward
CNT308572Solanum lycopersicumZea mays62.3571.3882.13207forward
CNT30715025Solanum lycopersicumMalus domestica golden62.9526.5279.9209forward
CNT30624536Solanum lycopersicumDaucus carota48.4911.4684.47161forward
CNT30368346Solanum lycopersicumSorghum bicolor62.3576.6783.09207forward
CNT30359648Solanum lycopersicumLactuca sativa48.4941.2881.99161forward
CNT30704829Solanum lycopersicumPrunus avium24.112.8888.7580forward
CNT3051600Solanum lycopersicumAmborella trichopoda23.192085.7177forward
CNT30119031Solanum lycopersicumCitrus clementina47.5920.8281.65158forward

Expression of CNT30511681

Peptides detected in this lncRNA

>peptide 1 (75 aa)
MDNSRESTNNRRLSARSSEKISTSKMRNVMSNFKESLSTSTSSMNNTFRSNSQGRNIVVHRTTSICCQERGVVCA*

Sequence

>CNT30511681
CCTAAGTTCATGTTCAAGTAATTAACACGAAATTACCTCTCTGGTGTAGAACTTGACAGCAAAACCACGAATGTCCCTGATAGACTCGGGGCTTCCACGT
TCATGGACAACAGTAGAGAATCGACAAATAACAGGCGTTTGAGCGCCAGGAGCTCGGAGAAAATCAGCACAAGTAAGATGAGAAATGTCATGAGTAACTT
CAAAGAATCCCTTAGCACTAGCACCTCTAGCATGAACAACACGTTCAGGTCCAACAGTCAAGGAAGAAACATTGTTGTACACAGGACCACCAGCATTTGT
TGTCAAGAAAGGGGTGTCGTATGCGCTTGATG