Detailed information on CNT30476611


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30673803Saccharum spontaneumSetaria viridis30.9492.6792.09215forward
CNT30521377Saccharum spontaneumSetaria italica66.3372.2689.59461forward
CNT30668585Saccharum spontaneumTriticum dicoccoides46.4738.8780.8323forward
CNT30141122Saccharum spontaneumLolium perenne25.945.4590.56180forward
CNT30368505Saccharum spontaneumSorghum bicolor32.9537.4296.94229forward
CNT30147657Saccharum spontaneumBrachypodium distachyon11.9435.0285.5483forward

Expression of CNT30476611

Peptides detected in this lncRNA

>peptide 1 (29 aa)
MAPRLMSCSTPLPMASTMVALCPLACSGV*

Sequence

>CNT30476611
GTGTCACATGATGAACAAGAGATAATTATGCTTAATCGATTGATTATTTCTTGCTGATCACCTCCATCATCTTGTTGCCTGCTTCGATTCCAGCTAAAAA
ATACAATACAATTAATCTGATTCCCCTCCCCTAACTTGAGGGGCCCGGCCAGCAAACCAACCAACCAGCCAGCCCCCGACTCCCGGAGCTAGCTCTAGGC
CGAGATGGCCGGGTGGCAGTAGGCCCCGCTGACCCATCCGTCCGCGATCTTCTTGTACGCCGCCTCCGTGAGGTGGATGCCGTCCCAGCTGAGCGACGAC
GACGGGTTGGAGCAGGCGTAGGCGCCGGACATGCCGCAGCGCGCGCTGTTCTGGTAGTTGTACTTGCCGCCGCCGGCGCCGCAGCAGCGAGTTGTGCTGC
GCCGACAGCGCGTTGAAGCGCTTCAGGCAGCCGTACTGGTCGTAGTCGCCGGCGTTGGAGGTCTGGTACAGGGTGAGGTAGATCGGGAAGCAACCCACGG
GGAGCACGCCGGGGACGACCACGTACATGGCGCCCAGGCTGATGAGCTGCTCCACGCCCTTGCCGATGGCGTCCACGATGGTGGCGCTCTGCCCGCTGGC
TTGCTCCGGGGTGTAGCCACCGAAGATCTGCGCGTTGTAGTCGTTGCCGCCGAACTCGCCCAGCACGAACAGGGACTTGGACAGGTACGACTTGC