Detailed information on CNT30466486


BLAST search results

BLAST vs Swiss-Prot:
sp|Q9FMF7|DIT21_ARATH, E-value = 3e-63

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30678071Saccharum spontaneumSetaria viridis52.811681.38188forward
CNT30522431Saccharum spontaneumSetaria italica49.7224.9680.23177forward
CNT30307554Saccharum spontaneumTriticum aestivum77.8150.4688.45277forward

Expression of CNT30466486

Peptides detected in this lncRNA

>peptide 1 (29 aa)
PVAAIAQDKSRVSWPMGRWACFPTRATAT*

Sequence

>CNT30466486
CCTGTAGCTGCGATTGCACAAGATAAGAGCCGAGTTTCTTGGCCGATGGGTCGTTGGGCTTGCTTCCCGACGAGAGCGACAGCGACTTGACGATGGGAAG
GAAAACCCCTCCTGCCCTGGCCGTAGTGCTAGGCATGGCAGGCGAGATGAAAGCCTCGCTGATGGCAAGCCCATAGGATAGGCCCAAAGTGCTGCGCCCC
AGCCATTTGACGAAGTAGGTGGCGACGCGGTCGCCGAGGCCGGTCTTGACGAAGCCGCGCGCGAAGAAGAAGGAGATGACGATGAGCCAGATGACCTCGT
TAGTGAACGCCCCGAACGCGGCGGCGAAGGGGAGCGTGCGCGTGGCGACGGTGGCG