Detailed information on CNT30452605


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30520700Saccharum spontaneumSetaria italica28.144.0189.39132forward
CNT30362231Saccharum spontaneumSorghum bicolor40.7235.797.38191forward

Expression of CNT30452605

Peptides detected in this lncRNA

>peptide 1 (39 aa)
MLVTSIQVPSPTIVPICSHQKKGTSKASQESTRFSNVKC*

Sequence

>CNT30452605
GAATGATTGCTGCATTAAAATGGTGAAAGGTAAACTTAGTATTTTACAAACGTGATCTTTGTCCTTTTATTATGCTTATAGAAAGCTGAGACCACAGTAC
CACACTAACAAAAAGCTAGAGAAAGAAACACACATCTACAAGCTTTACTTGGTCAGCATTCTGAATTACAATTCTACTCAAAAAAATTCAAGTGACCCAA
AACAAAAGATACTTAGCCTACAGAGACCTAAATCCAGAACAAACAGTAGCAATTACATGGCATCAGCTTGGTCACCAACGGGCATGGCATCAACGTAGTT
TGCTTGATGCTGGTTACCAGCATACAAGTTCCTTCGCCCACGATTGTGCCCATCTGTTCCCACCAAAAGAAAGGGACGTCAAAAGCTTCGCAGGAATCAA
CAAGATTCTCAAATGTAAAATGTTGACCTCATGGCACTATCATGACCTGAACAGGATCGCCAACTATCA