Detailed information on CNT30452483


BLAST search results

BLAST vs Swiss-Prot: nothing found

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
nothing found

Expression of CNT30452483

Peptides detected in this lncRNA

>peptide 1 (51 aa)
MHGAEDEDEHSTNNTTTTSKERACDQKHRWATTTTNTNTQTRRQRQRRTTR*

Sequence

>CNT30452483
TTTTTTTCATTGACTGACTGATGATAAACAACTTGACAGGGGTAAACATCCATCGACCCCAGGCCAGTTCATGCTGATTGATGCACGGGGCCGAAGACGA
GGACGAACACAGCACTAACAACACAACAACAACATCGAAGGAGCGAGCTTGCGATCAAAAACACAGATGGGCAACAACAACAACAAACACGAACACACAG
ACACGACGACAACGACAACGACGAACAACAAGATAAACCCCGCTCTGGACTAGGGTAACACAGCAACACGGTAGCAGTAGCGAACAAGATAACTTGGCCG
CGCGGGCCCCACCGCTCAGTTCCTCCAGCTCCCCTCGGAGTTGCCGTACCCGCCGCCGCGGCTGCCACCGCCGTAGCCGCCACCGCCGCCGCCGTAGCCG
CCACCGCCACCGCTGCGGCCACCGTAGCCACCGCCGCCGTAGCCGCCGCCGCCACCGCTGTAGCCACCTCCATCACGGCGGCCGTAGCCGCCACCGCCTC
CACGGCCGCCGCCGTAGCCGCCGCCACCCCCGCCGGAGCGCGGGCCGCCGACGAAGCAGCGGTACTCAACGTCCGATGCCGCCATCTCGTTCCGCTCACC
CACGAACCCGAACCCGGAGAACCTGACGAACCCGAACCCGAACCTGAGGGGGAGGAGAAGCCAAC