Detailed information on CNT30451383


BLAST search results

BLAST vs Swiss-Prot:
sp|P49637|R27A3_ARATH, E-value = 3e-56

BLAST vs NONCODE: nothing found

Results of reciprocal BLAST search (potential orthologs)
TargetQuery speciesTarget speciesQuery coverage (%)Target coverage (%)IdentityAlignment length (nt)Orientation
CNT30671969Saccharum spontaneumSetaria viridis39.7575.4395.02221forward
CNT30641194Saccharum spontaneumNymphaea colorata32.3719.7486.67180forward
CNT30531335Saccharum spontaneumEucalyptus grandis14.7527.5297.5682forward
CNT30371729Saccharum spontaneumArabidopsis thaliana29.6830.2283.64165forward
CNT30161234Saccharum spontaneumPistacia vera26.4463.0985.03147forward
CNT30287025Saccharum spontaneumTriticum aestivum38.4938.9189.72214forward
CNT30553249Saccharum spontaneumOryza glaberrima35.7936.3190.45199forward
CNT30231250Saccharum spontaneumAnanas comosus31.2937.3490.23174forward
CNT30650917Saccharum spontaneumRosa chinensis31.8327.790.4177forward
CNT30362394Saccharum spontaneumSorghum bicolor38.4933.1397.2214forward
CNT30324863Saccharum spontaneumAsparagus officinalis13.8534.2285.7177reverse complement
CNT30496106Saccharum spontaneumDigitaria exilis38.4930.4892.99214forward

Expression of CNT30451383

Peptides detected in this lncRNA

>peptide 1 (29 aa)
HNMHHKSIARMKVEQLVAQIALIYLKYLI*

>peptide 2 (37 aa)
MVLVEEDAVVVHATRVTATSRVLPVLADTAVPGGDVAA

>peptide 3 (30 aa)
MRWWCMPPALPRPPGCFRCLPIRPCPAETWP

Sequence

>CNT30451383
CCCACAACATGCATCATAAATCAATTGCACGGATGAAAGTAGAACAATTGGTAGCACAGATAGCTTTAATATATCTGAAATATTTGATATGAACTTGCAT
CAAAATCCTCACAAGCCCTGTAACAACAGGCAGCAGCCACAGATTTAAAAACTACAAGTCTTCTTAACACAAATAGCTGAGACAGGAAAGCACTACTAGT
TCAGATGTAGATCTCAAAACCAAGAGGCGAACAAGTACTGAAACCTAGGCGGTGAGCACGACGGCGCCGCCGGCGGCCTTGATCTTCTTCTCGGCGACCT
TGGAGATGAGCTTGGCCTTGACGACGATGGGCTTGGGCGGCAGCACCATCGACCAGAGGCGCTCGATGTTGACCGCGGGGCAGTAGAACTTGTTGCGGAG
CTTGTGGAAGTAGCGCATGCCGACCTTGCCGAAGTAGCCCGGATGGTACTTGTCGAAGAGGATGCGGTGGTGGTGCATGCCACCCGCGTTACCGCGACCT
CCCGGGTGCTTCCGGTGCTTGCCGATACGGCCGTGCCCGGCGGAGACGTGGCCGCG